THE  STUDY  OF  DNA


I  HAVE  A  SET  OF  DVDs  ON  GENETICS  AND  DNA,  BY  A  PhD

GUY,  FROM  “THE  TEACHING  COMPANY.”


IT  IS  24  HALF  HOUR  LECTURES.


GENETICS  IS  TRULY  MIND-BLOWING!


HOW  ANYONE  STUDYING  THIS  CAN  STILL  DECLARE  “THERE IS NO GOD”  JUST  MAKES  ME  SHAKE  MY  HEAD  IN  BEWILDERMENT  THAT  PEOPLE  CAN  STILL  FOOL  THEMSELVES  INTO  BELIEVING  THERE  IS  NO  GOD.


BUT  OF  COURSE  THE  BOTTOM  LINE  IS  THAT  THEY  DO  NOT  WANT  TO  BELIEVE  THERE  IS  A  GOD,  BECAUSE  IF  THEY  DO,  THE  NEXT  COMMON  STEP  WOULD  BE  ADMITTING  GOD  CAN  THEN  INSPIRE  A  BOOK  TO  BE  WRITTEN,  THAT  TELLS  US  HOW  WE  SHOULD  BE  LIVING. 


DNA….. FROM  THE  FIRST  LECTURES:


DNA  IS  INSIDE  A  GENE.  


WE  HAVE  24,000  GENES  IN  THE  HUMAN  BODY.


DNA  IS  LONG  STRANDS = POLYMER [BEADS  ON  A  CHAIN]


THE  BEADS  ARE MONOMER [MILLIONS  OF  UNITS]


4  NITROGEN  BASES  MAKE  UP  DNA.


ADENINE = A

THYMINE = T

GUANINE = G

CYTOSINE = C


MANY  DIFFERENT  ORDER  OF  THE  BEADS  IN  DIFFERENT  AMOUNTS.


PHOEBUS  LEVENE [1869 - 1940] — SPENT  30  YEARS  STUDYING  DNA.


HE  DISCOVERED  THE  BEADS  WERE  ATTACHED  TO  A  BACK-BONE— A  SUGAR-PHOSPHATE  BACK-BONE.


ONE  OF  HIS  STUDENTS  CALLED  IT  DEOXYRIBONUCLIAC  ACID = DNA.


SO  THIS  IS  LIKE:


A  GOLD  CHAIN  FROM  WHICH  HAND  LITTLE  CHAINS  AND  THE  BEADS  ARE  ON  OR  HANG  FROM  THE  LITTLE  CHAINS.


THE  BACK-BONE  IS  THE  GOLD  CHAIN.


THE  BASES  OR  BEADS  ARE—— A  T  G  C


LEVENE  SAID  THE  CHAIN  IS  VERY,  VERY,  VERY,  VERY  LONG  WITH  REPEATING  UNITS.  HE  SAID  THE  REPEATING  UNITS  WERE  A  T  G  C.


HENCE—— ATGCATGCATGCATGC—— FOR  HIM  IT  WAS  VERY  BORING  REPEAT  OF  UNITS.


HENCE  IF  HE  WAS  CORRECT  IT  LACKED  THE  KEY  TO  GENE  INTELLIGENCE;  WITH  24,000  GENES  WITH  SOMETHING  AS  BORING  AS  THAT  COULD  NOT  GIVE  THE  EXPRESSION  TO  COMPLICATE  LIFE  STRUCTURES.


LEVENE  WAS  A  TOWERING  PERSONALITY  AND  A  STUPENDOUS  CHEMIST;  PEOPLE  BELIEVED  HIM  AND  SAID  DNA  IS  OUT  AS  KEY  TO  COMPLICATED  LIFE  STRUCTURES.  


THIS  WAS  THE  1930s.


IN  THE  LATE  1940s  ERWIN  CHARGAFF [1905 - 2002]  ANOTHER  CHEMIST,  TOOK  A  LOOK,  AND  FOUND  LEVENE  WAS  WRONG!


IT  WASN’T  ATGCATGCATGC   AT  ALL!


IT  WAS  HIGHLY  VARIABLE!


LIKE—— ATCGGCTATCGAATTCCG    ETC.


CHARGAFF  DISCOVERED  THERE  WAS  AN  EQUAL  AMOUNT  OF  ATGC  FOR  HUMANS = 100%


FOR  THE  EUCALYPTUS  PLANT  ANOTHER  EQUAL  AMOUNT  OF  ATGC = 100%


HE  DISCOVERED  SAY  20%  OF  A  =  20%  OF  T

30%  OF  G  =  30%  OF  C = 100%


ANOTHER  CREATURE  COULD  BE  18%  A  18%  T

32%  G  32%  C = 100%


NOW  FITTING  ALL  THESE  OBSERVATIONS  TOGETHER—


PHYSICAL  CHEMISTRY  LOOKS  AT  ATOMS  IN  A  3  DIMENSION  SPACE.


WATER  MOLECULES  H2O =  ALL  THE  SAME,  NO   DIFFERENCE  IN  ANY  WATER  MOLECULES.

HUMANS  ARE  70%  WATER;  NO  COMPLICATED INSTRUCTIONS  OF  HUMAN  STRUCTURE  IN  WATER.


DNA  =  MILLIONS  OF  ATOMS.


WAS  THERE  A  SHAPE  TO  DNA?


SHINING  X-RAYS  THROUGH  IT—


RAYS  GO  IN - GET  BOUNCED  AROUND  BY  ALL  THE  ATOMS  -  COME  OUT  AT  THE  OTHER  END.  PUT  A  PHOTO-GRAPHIC  PLATE  THERE,  AND  A  PATTERN  IS  SHOWN  ON  HOW  MUCH  BOUNCING  AROUND  TAKES  PLACE.


THE  X-RAY  PATTERNS  WERE  FOUND  TO  BE  VERY  REGULAR.


MAURICE  WILKINS [1916 - 2004]  AND  ROSALIND  FRANKLIN [1920 - 1958],  WORKING  AT  KINGS  COLLEGE,  LONDON,  IN  THE  EARLY  1950s.


THEY  DID  X-RAY  ANALYST  OF  DNA,  AND  FOUND  REGULARITY,  LIKE  A  COIL  OR  POPULAR  SLINKY  COIL,  CALLED  HELIX.


JAMES  WATSON  [B. 1928]   AND  FRANCIS  CRICK [1916 - 2004]

WORKING  AT  CAMBRIDGE  UNIVERSITY,  LOOKED  AT  ALL  THIS.


MAYBE,  JUST  MAYBE  DNA  IS  A  DOUBLE  HELIX —— TWO  POLOMER—— SUGAR/PHOSPHATE  ON  THE  OUTSIDE  FOR  THE  BACK-BONE.


THEY  TRIED  TO  PUT  IT  ALL  TOGETHER.


THE  ONLY  WAY  WAS   A  DOUBLE-HELIX.


ON  THE  OUTSIDE  AND  BEADS  AT   A T G C   ON  THE  INSIDE,  JUST  FITTING  TOGETHER  LIKE  A  BASEBALL  IN  A  GLOVE - FITTING  BUT  NOT  TIGHTLY - NOT  A  BOND,  FITTING  WEAKLY  BUT  A  FIT.


NO  OTHER  STRUCTURE  WORKED  BUT  A  DOUBLE-HELIX.


CRICK’S  WIFE  WAS  AN  ARTIST,  SHE  DREW  A  DOUBLE-HELIX.


THEY  PUBLISHED  A  ONE  PAGE  ARTICLE  TO  PROVE  THEIR  POINT.


THIS  MODEL  WAS  IMMEDIATELY  ACCEPTED.


A  BEAUTIFUL  ELEGANT  STRUCTURE;  THEY  WON  THE  NOBEL  PRIZE.


FOUR  REQUIREMENTS  -  DNA


1. INFORMATION  STORAGE.

2. ACCURATE  DUPLICATION

3. EXPRESSION  AS  PHENOTYPE

4. ABILITY  TO  CHANGE [MUTATE]


1.  DNA  INFORMATION  


USING   A  T  G  C    IN  VARIOUS  PATTERNS—— HUGE  LANGUAGE!


BUT  A   AND  T   ARE  ALWAYS  TOGETHER,  THEY  FIT  TOGETHER  LIKE  BASEBALL  INTO  GLOVE.

AND  G  AND  C  ARE  ALWAYS  TOGETHER,  BASEBALL  INTO  GLOVE.


A  AND  T  =  ONE  PAIR


G  AND  C = ONE  PAIR


EXAMPLE:


469  BASE  PAIRS   OF  DNA  FOR  HUMAN  INSULIN.

THE  GENE  THAT  GIVES  US  INSULIN  IS  469  BASE  PAIRS.


THE  BEGINNING  OF  THIS  GENE  IS——


AGCCCTCCAGGACAGGCTGCAT………….


THE  OTHER  STRAND  IS  THERE  BECAUSE  WHERE  YOU  HAVE  AN  A  YOU  HAVE  T.  WHERE  YOU  HAVE  A  G  YOU  HAVE  C.


SO  WE  HAVE,  LOOKING  AT  THE  BEADS  ABOVE  FOR  INSULIN,  WE  HAVE——


A G C C C T C C A

T C G G G A G G T        ETC.


IF  WE  KNOW  THE  ONE  STRAND  WE  KNOW  THE  OTHER  STRAND.


HUMANS  HAVE  OVER  3  BILLION  BASE  PAIRS  OF  DNA—— LOTS  OF  INFORMATION.


INFORMATION  THAT  MAKES  YOU  YOU—— HAIR  COLOR,  EYE  COLOR,  DIMPLE,  SHAPE  OF  EYES,  SHAPE  OF  NOSE,  ETC.


2.  DNA  REPLICATION


WATSON  AND  CRICK  SAID  IT  HAS  NOT  GONE  UN-NOTICED  OUR  DOUBLE-HELIX  IS  GREAT  FOR  DUPLICATION.


LIKE  A  ZIPPER  IT  CAN  UNWIND  EASILY.


A  LOOSE  CONNECTION   A  AND  T     G  AND  C  ——  UNZIPPING.


THE  OLD  STRANDS  ACT  AS  A  TEMPLATE  FOR  THE  NEW  STRANDS.


STRAND  AAAAA

WITH       TTTTT


UNZIP


AAAAA


TTTTT


SOMETHING  COMES  INTO  PLAY  TO  MAKE  A  NEW  STRAND


AAAAA  - OLD

TTTTT  - NEW


TTTTT  - OLD

AAAAA  - NEW


THE  SAME  FOR  G  AND  C


THIS  WE  CALL  SEMI-CONSERVATISM  REPLICATION—— IT  HAS  NOTHING  TO  DO  WITH  POLITICS.


YOU  ARE  CONSERVING  THE  OLD  STRAND  OF  DNA.


YOU  ARE  ADDING  OR  REPLICATING [DUPLICATING]  NEW  STRANDS.


MOTHER  AND  FATHER  =  DNA [SPERM]  DNA[EGG]


COMBINE  =  ONE  CELL


CELL  DIVIDES  =  REPLICATING  


CELLS  DIVIDE  -  MORE  AND  MORE  =  NEW  PERSON.


IS  IT  POSSIBLE  TO  HAVE  A  CELL  WITH  PARENTS  DNA  SOMEWHERE  IN  ALL  OUR  CELLS?


MAYBE!


WE  HAVE  ABOUT  60  TRILLION  CELLS  IN  THE  HUMAN!


………………..


I  SHALL  CONTINUE  THIS  PART  OF  GENETICS  IN  THE  SECOND  PART - Keith Hunt


NOW  WITH  WHAT  WE  HAVE  LEARNT  SO  FAR——


WHO  INVENTED  THIS  DNA?  IT  IS  A  HUGE  LANGUAGE  AS  WE  HAVE  SEEN.  COULD  THIS  BASIC  4  LETTER  LANGUAGE  JUST  HAVE  INVENTED  ITSELF?  469  BASE  PAIRS  TO  TELL  WHATEVER,  TO  MAKE  INSULIN!


COULD  RANDOM  CHANCE  OF  THESE  FOUR  CHEMICALS  FALLING  TOGETHER  IN  469  BASE  PAIRS,  JUST  BY  CHANCE  THROUGH  EVOLUTION,  HAVE  HAPPENED  BY  CHANCE?


DOES  EVOLUTION  HAVE  A  MIND,  A  BRAIN;  DOES  IT  SPEAK  TO  ITSELF  AND  SAY,  “OKAY  YOU  FOUR  CHEMICALS  EXPERIMENT  AROUND  UNTIL  YOU  FORM  A  LANGUAGE  OF  WHAT  YOU  HAVE  TO  TELL  THIS  OTHER  THING/S  TO  FORM  AND  MAKE  INSULIN".


HOW  COULD  EVOLUTION  WITH  NO  BRAIN  DECIDE  THAT  YOU  HAVE  TO  GET  469  BASE  PAIRS  OF  DNA  FORMED  TOGETHER  TO  HAVE  THE  LANGUAGE  TO  TELL  THE  NEXT  WHATEVER  OF  EVOLUTION,  TO  START  MAKING  INSULIN  FOR  THE  HUMAN  BODY,  WHICH  WITHOUT  YOU  ARE  GOING  TO  SERIOUSLY  MESS  UP  THE  HUMAN  BODY  WHICH  WILL  NOT  SURVIVE.


AND  WHEN  YOU  PUT  THAT  WITH  ALL  THE  MANY  MANY  OTHER  THINGS  OF  THE  HUMAN  BODY,  THAT  NEEDS  TO  BE  PUT  TOGETHER  CORRECTLY……. I  MEAN….. YOU  DON’T  HAVE  HAIR  GROWING  OUT  OF  YOUR  EYES,  OR  FROM  YOUR  FINGER  NAILS.  YOU  DON’T  HAVE  TWO  HEARTS  ONE  ON  EACH  SIDE  OF  YOUR  CHEST.


IF  EVOLUTION  IS  IN  CHARGE  YOU’D  THINK  IT  COULD  HAVE  100  OR  50  BASE  PAIRS  OF  DNA  TO  MAKE  INSULIN,  AND  NOT  469—— WHY  NOT  470,  WHY  ON  EARTH  469,  AN  ODD  NUMBER  TO  SAY  THE  LEAST.


AND  THIS  IS  JUST  THE  START  OF  THE  PATHWAY  FOR  INSULIN  TO  BE  MADE.


HOW  DID  EVOLUTION  DECIDE  ON  DUPLICATING?  DID  EVOLUTION  SAY  TO  ITSELF,  “WELL  WE  WILL  UN-ZIP  OUR  DNA  STRAND?”  BEFORE  EVEN  THAT,  HOW  DID  EVOLUTION  DECIDE  IT  WOULD  BE  A  DOUBLE-HELIX?  THEN  EVEN  BEFORE  THAT  HOW  DID  EVOLUTION  DECIDE  UPON  4  CHEMICALS  FOR  A  and  T    G  and  C ?  WHERE  DID  THEY  COME  FROM?  HOW  DID  EVOLUTION  DECIDE  A  WOULD  COUPLE  WITH  T  AND  G  WOULD  COUPLE  WITH  C ?   AFTER  UN-ZIPPING  HOW  DID  EVOLUTION  FIGURE  HOW  TO  MAKE  A  NEW  STRAND  THAT  WOULD  COUPLE  WITH  THE  OLD  STRAND?  HOW  DID  EVOLUTION  DECIDE  A  AND  T  TOGETHER  AND  G  AND  C  TOGETHER  WOULD  BE  THE  BASE  FROM  WHICH  A  LANGUAGE  WOULD  COME  TOGETHER;  AND  HOW  DID  EVOLUTION  DECIDE  THE  A T G C  WOULD  NOT  BOND  BUT  BE  LOOSE  YET  CONNECTED?  


THERE  ARE  SO  MANY  PARTS  TO  THE  HUMAN  BODY  EACH  WITH  ITS  CODE  OF  LANGUAGE,  HOW  COULD  SLOW  EVOLUTION,  OR  EVEN  A  QUICK  MUTATION,  EVER  KEEP  ALL  OF  THESE  DNA  LANGUAGE  SEPARATE  FROM  EACH  OTHER?  


BACK  TO  INSULIN——


AS  THESE  24  LECTURE  ON  GENETICS  SHOW  THERE  ARE  A  NUMBER  OF  MAZING  THINGS  YOU  MUST  HAVE,  FOR  THE  BASIC  BLUEPRINT  OF  INSULIN  TO  COME  INTO  BEING;  THE  CORRECT  LANGUAGE  OF  THE  BLUEPRINT  IS  ONLY  THE  BEGINNING,  YOU  HAVE  TO  HAVE  OTHER  THINGS  THAT  PUTS  THE  LANGUAGE  INTO  THE  PRACTICALITY  OF  LITERALLY  MAKING  ALL  THAT  IS  INSIDE  THE  INSULIN,  TO  DO  WHAT  IS  REQUIRED  OF  IT  IN  THE  HUMAN  BODY,  FOR  THAT  BODY  TO  FUNCTION  IN  A  NORMAL  MANNER.


AND  WHO  DECIDED  WE  HAVE  TO  HAVE  INSULIN  IN  THE  FIRST  PLACE?


DID  EVOLUTION  SIT  DOWN  AND  SAY,  “WELL  NOW,  FOR  US  TO  MAKE  A  HUMAN  PERSON,  WE  WILL  DECIDE  ONE  PART  OF  THAT  NORMAL  LIVING  PERSON  WILL  HAVE  TO  HAVE  INSULIN,  AND  THIS  IS  HOW  WE  SHALL  DO  IT.”


WHEN  YOU  ADD  UP  ALL  THE  PARTS  IN  A  NORMAL  HUMAN  PERSON,  HOW  ALL  PARTS  MUST  FIT  TOGETHER  CORRECTLY  TO  MAKE  A  LIVING  PERSON,  AND  TO  THINK  EVOLUTION,  EVEN  GIVEN  MILLIONS  OF  YEARS  COULD  EVER  DO  SUCH  A  MIRACULOUS  FEAT  OF  ENGINEERING,  IS  BEYOND  ALL  COMMON  SENSE,  BUT  COMMON  SENSE  JUST  AIN’T  COMMON  TODAY!


AND  WHILE  EVOLUTION  WAS  TRYING  THIS  AND  TRYING  THAT,  AS  IT  STUMBLED  ALONG  OVER  MILLIONS  OF  YEARS,  TO  GET  THE  HUMAN  AS  HE  IS  TODAY,  WHY  HAVE  WE  NOT  FOUND  ALL  KINDS  OF  STRANGE  AND  FREAKISH  “HUMANS”    IN  THE  GROUND,  AS  EVOLUTION  MESSED  UP  DOWN  THROUGH  TIME,  TO  COME  UP  WITH  THE  FINAL  HUMAN  BEING  WE  HAVE  ON  EARTH  TODAY.


AS  ONE  SERIOUS  JOKE  GOES—— IF  WE  HUMANS  DESCENDED  FROM  MONKEYS,  WHY  DO  WE  STILL  HAVE  MONKEYS?


AND  I  COULD  ADD  WHY  HAVE  WE  NOT  FOUND  1/2  MONKEY  AND  1/2  MAN,  OR  ANY  OTHER  MIXED  PERCENTAGE,  SOMEWHERE  IN  THE  GROUND?  


SO  WE  ARE  BACK  TO  SAYING  WHO  TOLD  EVOLUTION  THAT  IT  WOULD  TAKE  469  BASE  PAIRS  OF  DNA  JUST  TO  MAKE  INSULIN?    


AS  GOD’S  WORD  THE  HOLY  INSPIRED  BIBLE  SAYS,  ONLY  THE  FOOL  HAS  SAID  IN  HIS  HEART  THERE  IS  NO  GOD [PS. 14: 1].


Keith Hunt